Original source

Variants (including SNPs and indels) imported from dbSNP (release 144)|View in dbSNP

Alleles
TGGCAGTAAGCTAAATTCTGTTGGAACATCCATGGAAATTGCCAG/-
Location

Chromosome 8:118947213-118947257 (forward strand)|View in location tab

Most severe consequence
 
Intron variant
Evidence status

HGVS names

This variant has 3 HGVS names - Show

About this variant

This variant overlaps 2 transcripts.

Variant displays