This variant has been flagged

  • None of the variant alleles match the reference allele (TGTAAGATAGGGAGCTGGGAAGGACAAGTTGGGTGGCAGGGGTGGGCCTGCGTGGTGCCC CGGGGACTGAGGCTGGGATAGACCTAGTCTGCAGGTTTGATAGCTAGGCTAGAAGGCCTG GGTGGATGGACTCAAGGAGCTGAGTATTTGGGCAGAGGTGGTGCAGCAAAAGGCTCTGGG CTTTGGGAGGTGCTCACCA)
  • Mapped position is not compatible with reported alleles
Original source

Variants (including SNPs and indels) imported from dbSNP (release 144)|View in dbSNP

Alleles
A/T|Ambiguity code: W
Note: The reference sequence for this variant (A) does not match the Ensembl reference sequence at this location. Click the plus to show all of the sequence
Location

Chromosome 1:161230920-161231118 (forward strand)|View in location tab

Most severe consequence
 
Splice acceptor variant
Evidence status

Synonyms

Archive dbSNP rs17400691, rs3204608

HGVS names

This variant has 75 HGVS names - Show

About this variant

This variant overlaps 90 transcripts and has 1 sample genotype.

Variant displays