This variation has been flagged

  • None of the variant alleles match the reference allele (C)
  • Mapped position is not compatible with reported alleles
Original source

Variants (including SNPs and indels) imported from dbSNP (release 138) | View in dbSNP

Alleles
-/CCTGGGGGGTCTTCTAACTACTGG | Ancestral: C
Location

Chromosome 1:110145759 (forward strand) | View in location tab

Most severe consequence
Evidence status

HGVS name

1:g.110145759delCinsCCTGGGGGGTCTTCTAACTACTGG

Variation displays