This variation has been flagged

  • None of the variant alleles match the reference allele (C)
  • Mapped position is not compatible with reported alleles
Original source

Variants (including SNPs and indels) imported from dbSNP (mapped to GRCh38) (release 138) | [View in dbSNP]

Alleles
-/CCTGGGGGGTCTTCTAACTACTGG | Ancestral: C
Location

Chromosome 1:109603137 (forward strand) | View in location tab

Most severe consequence
Evidence status

This variation has 3 HGVS names - click the plus to show

Variation displays