Original source

Variants (including SNPs and indels) imported from dbSNP (release 144)|View in dbSNP

Alleles
ACCATTTGTTATTGCCTGTCC/-
Location

Chromosome 19:45411470-45411490 (forward strand)|View in location tab

Co-located variant

dbSNP rs398034786 (ACCATTTGTTATTGCCTGTCC/-)

Most severe consequence
 
Intron variant
Evidence status

HGVS names

This variant has 8 HGVS names - Show

About this variant

This variant overlaps 19 transcripts.

Variant displays