Original source

Variants (including SNPs and indels) imported from dbSNP (release 142) | View in dbSNP

Alleles
ACCATTTGTTATTGCCTGTCC/-
Location

Chromosome 19:45411449-45411469 (forward strand) | View in location tab

Most severe consequence
 
Intron variant

This variant has 8 HGVS names - click the plus to show

About this variant

This variant overlaps 19 transcripts.

Variant displays