Original source

Variants (including SNPs and indels) imported from dbSNP (release 142) | View in dbSNP

Alleles
GTTATTCATGGCTCAACAAAGCTTTGACAAGCCAAAAAG/- | MAF: 0.05 (-)
Location

Chromosome 13:27619239-27619277 (forward strand) | View in location tab

Most severe consequence
 
Intron variant
Evidence status

Synonyms

Archive dbSNP rs146066472

This variant has 2 HGVS names - click the plus to show

About this variant

Variant displays